ayshearouse7276 ayshearouse7276
  • 03-09-2018
  • History
contestada

What had indians done for many years to make the land suitable for hunting and travel that colonial laws prohibited?

Respuesta :

annjoy
annjoy annjoy
  • 23-09-2018

Native Americans would travel somewhere else until the soil would get a chance to recover. This would allow time for the soil replenishment.

Answer Link

Otras preguntas

Compliant is to stubborn as excited is to
Sue stacked one box onto another. The bottom box had the height of 2 1/3 feet and the top box had the height of 3 2/3 feet. How tall were the stacked boxes?
Express the perimeter of the triangle as a polynomial. 8x+2 5x-4 9x+3
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
what was NOT a primary goal of marriage in a feudal system at the noble level? A. Exchange of land and goods B. love and companionship C. Political arrangement
What was George Washington's nickname?
What Role Does the Sun Play in Producing Winds And Ocean Currents
A student government organization is selling Christmas trees as a fundraiser. On Friday, they sold 5 noble fir trees and 3 douglas fir trees for a total of $420
Ms Graves gave her class 12 minutes to read. Carrie read 5/1/2 pages in that time. At what rate, in the pages per hour, did Carrie read?
Emma uses a 250 meter roll of crepe paper to make streamers. How many dekameters of creme paper does emma use?