destinychavere destinychavere

01-05-2019
Mathematics

contestada

What is the property of 234+(-234)=0

Respuesta :

jazzychicken1 jazzychicken1

01-05-2019

I think it is 0 I am not really sure

Answer Link

bright1721 bright1721

01-05-2019

The answer is zero. That’s the answer

Answer Link

Otras preguntas

These tools were crucial in scientists' and physicians' ability to work together and collaborate to solve problems and learn about disease. A) the Internet and

A cylinder is filled with 900 liters of water.find the area of its base if height of cylinder is 20dm.

if you work in an adolescent oncology youth cancer office will the doctor more likely see patients with Hodgkin lymphoma or neuroblastoma explain your answer

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Triangle ABC has side lengths: AB = 3.5 cm, BC = 2.4 cm, and AC = 4.2 cm ΔABC ≅ ΔHJK What is the length of side HJ? HJ = ______cm

a chef uses 4 3/4 cups of broth for 10 servings of soup. How much broth is used In one serving

Find the parabola with equation y = ax2 + bx whose tangent line at (3, 12) has equation y = 10x − 18. y = incorrect: your answer is incorrect.

If two populations are isolated, they may become separate species because they are not longer ________.

Can someone Help me with that please

If 2/3 + 6 = 7/6p, what is the value of p?