amandadiodonet265 amandadiodonet265

01-03-2022
Health

contestada

A physics student takes her pulse and determines that her heart beats periodically 40 times in 20 seconds. The period of her heartbeat is.

Respuesta :

2022kreed79 2022kreed79

01-03-2022

Answer:

either .5 seconds or .2 seconds

Explanation:

I hope this helps you.

Answer Link

Otras preguntas

What was a major effect of the agricultural revolution in the united states during the late 1800's?

Observing people and asking them questions are the two principal ways to obtain

In 500 words, explain how the characters of Jem and Scout develop over the course of Part I of To Kill a Mockingbird. Discuss how they change and grow and what

What type of stock receives an equal part of the profits on each share to be distributed after all other obligations of a company have been satisfied? A.

What is one key difference between the radiation and convection zones?

If a family has three children, what is the probability that the family has at least one girl?

What is the pianist and the weary blues doing when he makes the piano moan with Melody

Find the measure of an exterior angle of each regular polygon: 100-gon.

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Simplify the expression completely. x squared over x to the power of 6